se

conf/fastq_screen.conf

+# This is an example configuration file for FastQ Screen
+
+############################
+## Bowtie, Bowtie 2 or BWA #
+############################
+## If the Bowtie, Bowtie 2 or BWA binary is not in your PATH, you can set 
+## this value to tell the program where to find your chosen aligner.  Uncomment 
+## the relevant line below and set the appropriate location.  Please note, 
+## this path should INCLUDE the executable filename.
+
+#BOWTIE	/usr/local/bin/bowtie/bowtie
+#BOWTIE2 /usr/local/bowtie2/bowtie2
+#BWA /usr/local/bwa/bwa
+
+
+
+############################################
+## Bismark (for bisulfite sequencing only) #
+############################################
+## If the Bismark binary is not in your PATH then you can set this value to 
+## tell the program where to find it.  Uncomment the line below and set the 
+## appropriate location. Please note, this path should INCLUDE the executable 
+## filename.
+
+#BISMARK	/usr/local/bin/bismark/bismark
+
+
+
+############
+## Threads #
+############
+## Genome aligners can be made to run across multiple CPU cores to speed up 
+## searches.  Set this value to the number of cores you want for mapping reads.
+
+THREADS		32
+
+
+
+##############
+## DATABASES #
+##############
+## This section enables you to configure multiple genomes databases (aligner index 
+## files) to search against in your screen.  For each genome you need to provide a 
+## database name (which can't contain spaces) and the location of the aligner index 
+## files.
+##
+## The path to the index files SHOULD INCLUDE THE BASENAME of the index, e.g:
+## /data/public/Genomes/Human_Bowtie/GRCh37/Homo_sapiens.GRCh37
+## Thus, the index files (Homo_sapiens.GRCh37.1.bt2, Homo_sapiens.GRCh37.2.bt2, etc.) 
+## are found in a folder named 'GRCh37'.
+##
+## If, for example, the Bowtie, Bowtie2 and BWA indices of a given genome reside in 
+## the SAME FOLDER, a SINLGE path may be provided to ALL the of indices.  The index 
+## used will be the one compatible with the chosen aligner (as specified using the 
+## --aligner flag).  
+##
+## The entries shown below are only suggested examples, you can add as many DATABASE 
+## sections as required, and you can comment out or remove as many of the existing 
+## entries as desired.  We suggest including genomes and sequences that may be sources 
+## of contamination either because they where run on your sequencer previously, or may 
+## have contaminated your sample during the library preparation step.
+##
+## Human - sequences available from
+## ftp://ftp.ensembl.org/pub/current/fasta/homo_sapiens/dna/
+#DATABASE	Human	/data/public/Genomes/Human_Bowtie/GRCh37/Homo_sapiens.GRCh37
+##
+## Mouse - sequence available from
+## ftp://ftp.ensembl.org/pub/current/fasta/mus_musculus/dna/
+#DATABASE	Mouse	/data/public/Genomes/Mouse/NCBIM37/Mus_musculus.NCBIM37
+##
+## Ecoli- sequence available from EMBL accession U00096.2
+#DATABASE	Ecoli	/data/public/Genomes/Ecoli/Ecoli
+##
+## PhiX - sequence available from Refseq accession NC_001422.1
+#DATABASE	PhiX	/data/public/Genomes/PhiX/phi_plus_SNPs
+##
+## Adapters - sequence derived from the FastQC contaminats file found at: www.bioinformatics.babraham.ac.uk/projects/fastqc
+#DATABASE	Adapters	/data/public/Genomes/Contaminants/Contaminants
+##
+## Vector - Sequence taken from the UniVec database
+## http://www.ncbi.nlm.nih.gov/VecScreen/UniVec.html
+#DATABASE	Vectors		/data/public/Genomes/Vectors/Vectors
+
+DATABASE	Human	/cromwell_root/tmp/fastq_screen_reference/genome
+DATABASE	Mouse	/cromwell_root/tmp/fastq_screen_reference/mouse
+DATABASE	ERCC	/cromwell_root/tmp/fastq_screen_reference/ERCC
+DATABASE	EColi	/cromwell_root/tmp/fastq_screen_reference/ecoli
+DATABASE	Adapter	/cromwell_root/tmp/fastq_screen_reference/adapters
+DATABASE	Vector	/cromwell_root/tmp/fastq_screen_reference/vector
+DATABASE	rRNA	/cromwell_root/tmp/fastq_screen_reference/rRNARef
+DATABASE	Virus	/cromwell_root/tmp/fastq_screen_reference/viral
+DATABASE	Yeast	/cromwell_root/tmp/fastq_screen_reference/GCF_000146045.2_R64_genomic_modify
+DATABASE	Mitoch	/cromwell_root/tmp/fastq_screen_reference/Human_mitoch
+DATABASE	Phix	/cromwell_root/tmp/fastq_screen_reference/phix

defaults

+{   
+    "fastp_docker": "registry.cn-shanghai.aliyuncs.com/pgx-docker-registry/fastp:0.19.6",
+    "fastp_cluster": "OnDemand bcs.b2.3xlarge img-ubuntu-vpc",
+    "trim_front1": "0",
+    "trim_tail1": "0",
+    "max_len1": "0",
+    "trim_front2": "0",
+    "trim_tail2": "0",
+    "max_len2": "0",
+    "adapter_sequence": "AGATCGGAAGAGCACACGTCTGAACTCCAGTCA",
+    "adapter_sequence_r2": "AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT",
+    "disable_adapter_trimming": "0",
+    "length_required": "50",
+    "length_required1": "20",
+    "UMI": "0",
+    "umi_len": "0",
+    "umi_loc": "umi_loc",
+    "qualified_quality_phred": "20",
+    "disable_quality_filtering": "1",
+    "hisat2_docker": "registry.cn-shanghai.aliyuncs.com/pgx-docker-registry/hisat2:v2.1.0-2",
+    "hisat2_cluster": "OnDemand bcs.a2.3xlarge img-ubuntu-vpc",
+    "idx_prefix": "genome_snp_tran",
+    "idx": "oss://pgx-reference-data/reference/hisat2/grch38_snp_tran/",
+    "fasta": "GRCh38.d1.vd1.fa",
+    "pen_cansplice":"0",
+    "pen_noncansplice":"3",
+    "pen_intronlen":"G,-8,1",
+    "min_intronlen":"30",
+    "max_intronlen":"500000",
+    "maxins":"500",
+    "minins":"0",
+    "samtools_docker": "registry.cn-shanghai.aliyuncs.com/pgx-docker-registry/samtools:v1.3.1",
+    "samtools_cluster": "OnDemand bcs.a2.large img-ubuntu-vpc",
+    "insert_size":"8000",
+    "gtf": "oss://pgx-reference-data/reference/annotation/Homo_sapiens.GRCh38.93.gtf",
+    "stringtie_docker": "registry.cn-shanghai.aliyuncs.com/pgx-docker-registry/stringtie:v1.3.4",
+    "stringtie_cluster": "OnDemand bcs.a2.large img-ubuntu-vpc",
+    "minimum_length_allowed_for_the_predicted_transcripts":"200",
+    "minimum_isoform_abundance":"0.01",
+    "Junctions_no_spliced_reads":"10",
+    "maximum_fraction_of_muliplelocationmapped_reads":"0.95",
+    "fastqc_cluster_config": "OnDemand bcs.b2.3xlarge img-ubuntu-vpc",
+    "fastqc_docker": "registry.cn-shanghai.aliyuncs.com/pgx-docker-registry/fastqc:0.11.8",
+    "fastqc_disk_size": "150",
+    "qualimapBAMqc_docker": "registry.cn-shanghai.aliyuncs.com/pgx-docker-registry/qualimap:2.0.0",
+    "qualimapBAMqc_cluster_config": "OnDemand bcs.a2.7xlarge img-ubuntu-vpc",
+    "qualimapBAMqc_disk_size": "500",
+    "qualimapRNAseq_docker": "registry.cn-shanghai.aliyuncs.com/pgx-docker-registry/qualimap:2.0.0",
+    "qualimapRNAseq_cluster_config": "OnDemand bcs.a2.7xlarge img-ubuntu-vpc",
+    "qualimapRNAseq_disk_size": "500",
+    "fastqscreen_docker": "registry.cn-shanghai.aliyuncs.com/pgx-docker-registry/fastqscreen:0.12.0",
+    "fastqscreen_cluster_config": "OnDemand bcs.b2.3xlarge img-ubuntu-vpc",
+    "screen_ref_dir": "oss://pgx-reference-data/fastq_screen_reference/",
+    "fastq_screen_conf": "oss://pgx-reference-data/fastq_screen_reference/fastq_screen.conf",
+    "fastqscreen_disk_size": "200",
+    "multiqc_cluster_config": "OnDemand bcs.b2.3xlarge img-ubuntu-vpc",
+    "multiqc_docker": "registry-vpc.cn-shanghai.aliyuncs.com/pgx-docker-registry/multiqc:v1.8",
+    "multiqc_disk_size": "100",
+    "ballgown_docker": "registry.cn-shanghai.aliyuncs.com/pgx-docker-registry/pgx-ballgown:0.0.1",
+    "ballgown_cluster": "OnDemand bcs.a2.large img-ubuntu-vpc",
+    "count_docker": "registry.cn-shanghai.aliyuncs.com/pgx-docker-registry/count:v1.0",
+    "count_cluster": "OnDemand bcs.a2.large img-ubuntu-vpc",
+    "count_length": "150",
+	"disk_size": "200"
+    }

inputs

+{
+	"{{ project_name }}.read": "{{ read }}",
+	"{{ project_name }}.sample_id": "{{ sample_id }}",
+	"{{ project_name }}.fastp_docker": "{{ fastp_docker }}",
+	"{{ project_name }}.fastp_cluster": "{{ fastp_cluster }}",
+	"{{ project_name }}.trim_front1": "{{ trim_front1 }}",
+	"{{ project_name }}.trim_tail1": "{{ trim_tail1 }}",
+	"{{ project_name }}.max_len1": "{{ max_len1 }}",
+	"{{ project_name }}.trim_front2": "{{ trim_front2 }}",
+	"{{ project_name }}.trim_tail2": "{{ trim_tail2 }}",
+	"{{ project_name }}.max_len2": "{{ max_len2 }}",
+	"{{ project_name }}.adapter_sequence": "{{ adapter_sequence }}",
+	"{{ project_name }}.adapter_sequence_r2": "{{ adapter_sequence_r2 }}",
+	"{{ project_name }}.disable_adapter_trimming": "{{ disable_adapter_trimming }}",
+	"{{ project_name }}.length_required1": "{{ length_required1 }}",
+	"{{ project_name }}.UMI": "{{ UMI }}",
+	"{{ project_name }}.umi_loc": "{{ umi_loc }}",
+	"{{ project_name }}.umi_len": "{{ umi_len }}",
+	"{{ project_name }}.length_required": "{{ length_required }}",
+	"{{ project_name }}.qualified_quality_phred": "{{ qualified_quality_phred }}",
+	"{{ project_name }}.disable_quality_filtering": "{{ disable_quality_filtering }}",
+	"{{ project_name }}.hisat2_docker": "{{ hisat2_docker }}",
+	"{{ project_name }}.hisat2_cluster": "{{ hisat2_cluster }}",
+	"{{ project_name }}.idx_prefix": "{{ idx_prefix }}",
+	"{{ project_name }}.idx": "{{ idx }}",
+	"{{ project_name }}.fasta": "{{ fasta }}",
+	"{{ project_name }}.pen_cansplice": "{{ pen_cansplice }}",
+	"{{ project_name }}.pen_noncansplice": "{{ pen_noncansplice }}",
+	"{{ project_name }}.pen_intronlen": "{{ pen_intronlen }}",
+	"{{ project_name }}.min_intronlen": "{{ min_intronlen }}",
+	"{{ project_name }}.max_intronlen": "{{ max_intronlen }}",
+	"{{ project_name }}.maxins": "{{ maxins }}",
+	"{{ project_name }}.minins": "{{ minins }}",
+	"{{ project_name }}.samtools_docker": "{{ samtools_docker }}",
+	"{{ project_name }}.samtools_cluster": "{{ samtools_cluster }}",
+	"{{ project_name }}.insert_size": "{{ insert_size }}",
+	"{{ project_name }}.gtf": "{{ gtf }}",
+	"{{ project_name }}.stringtie_docker": "{{ stringtie_docker }}",
+	"{{ project_name }}.stringtie_cluster": "{{ stringtie_cluster }}",
+	"{{ project_name }}.minimum_length_allowed_for_the_predicted_transcripts": "{{ minimum_length_allowed_for_the_predicted_transcripts }}",
+	"{{ project_name }}.minimum_isoform_abundance": "{{ minimum_isoform_abundance }}",
+	"{{ project_name }}.Junctions_no_spliced_reads": "{{ Junctions_no_spliced_reads }}",
+	"{{ project_name }}.maximum_fraction_of_muliplelocationmapped_reads": "{{ maximum_fraction_of_muliplelocationmapped_reads }}",
+	"{{ project_name }}.fastqc_cluster_config": "{{ fastqc_cluster_config }}",
+	"{{ project_name }}.fastqc_docker": "{{ fastqc_docker }}",
+	"{{ project_name }}.fastqc_disk_size": "{{ fastqc_disk_size }}",
+	"{{ project_name }}.qualimapBAMqc_docker": "{{ qualimapBAMqc_docker }}",
+	"{{ project_name }}.qualimapBAMqc_cluster_config": "{{ qualimapBAMqc_cluster_config }}",
+	"{{ project_name }}.qualimapBAMqc_disk_size": "{{ qualimapBAMqc_disk_size }}",
+	"{{ project_name }}.qualimapRNAseq_docker": "{{ qualimapRNAseq_docker }}",
+	"{{ project_name }}.qualimapRNAseq_cluster_config": "{{ qualimapRNAseq_cluster_config }}",
+	"{{ project_name }}.qualimapRNAseq_disk_size": "{{ qualimapRNAseq_disk_size }}",
+	"{{ project_name }}.fastqscreen_docker": "{{ fastqscreen_docker }}",
+	"{{ project_name }}.fastqscreen_cluster_config": "{{ fastqscreen_cluster_config }}",
+	"{{ project_name }}.screen_ref_dir": "{{ screen_ref_dir }}",
+	"{{ project_name }}.fastq_screen_conf": "{{ fastq_screen_conf }}",
+	"{{ project_name }}.fastqscreen_disk_size": "{{ fastqscreen_disk_size }}",
+	"{{ project_name }}.multiqc_cluster_config": "{{ multiqc_cluster_config }}",
+	"{{ project_name }}.multiqc_docker": "{{ multiqc_docker }}",
+	"{{ project_name }}.multiqc_disk_size": "{{ multiqc_disk_size }}",
+	"{{ project_name }}.ballgown_docker": "{{ ballgown_docker }}",
+	"{{ project_name }}.ballgown_cluster": "{{ ballgown_cluster }}",
+	"{{ project_name }}.disk_size": "{{ disk_size if disk_size != '' else 200}}",
+	"{{ project_name }}.count_docker": "{{ count_docker }}",
+	"{{ project_name }}.count_cluster": "{{ count_cluster }}",
+	"{{ project_name }}.count_length": "{{ count_length }}"
+}

manifest.json

+{
+  "name": "RNA-Seq QC for Quartet",
+  "short_name": "quartet-rnaseq-qc",
+  "description": "RNA Sequencing Quality Control Pipeline for Quartet.",
+  "home": "http://choppy.3steps.cn/lizhihui/quartet-rnaseq-qc",
+  "hidden": false,
+  "icons": [
+    {
+      "src": "",
+      "type": "image/png",
+      "sizes": "192x192"
+    },
+    {
+      "src": "",
+      "type": "image/png",
+      "sizes": "192x192"
+    }
+  ],
+  "category": "Pipeline",
+  "source": "PGx"
+}

schema.json

+{
+  "formMode":"batch",
+  "fields":[
+    {
+      "tmplType":"sample_id",
+      "type":"number",
+      "label":"Sample ID",
+      "name":"sample_id",
+      "question":"How many samples? For auto generating sample id.",
+      "placeholder":"How many samples? For auto generating sample id.",
+      "model":"sample_id",
+      "disabled":false,
+      "min":1,
+      "max":100,
+      "config":{
+        "rules":[{"type":"number","required":true,"message":"Please input a number."}]
+      }
+    },
+    {
+      "tmplType":"file",
+      "label":"Read1 Files",
+      "model":"read1",
+      "readOnly":false,
+      "multiple":true,
+      "filterType":"fastq|fastq.gz|fq|fq.gz",
+      "placeholder":"Select files for read1.",
+      "config":{
+        "rules":[
+          {
+            "type":"array",
+            "required":true,
+            "message":"Please select files for read1."
+          }
+        ]
+      }
+    },
+    {
+      "tmplType":"file",
+      "label":"Read2 Files",
+      "model":"read2",
+      "readOnly":false,
+      "multiple":true,
+      "filterType":"fastq|fastq.gz|fq|fq.gz",
+      "placeholder":"Select files for read2.",
+      "config":{
+        "rules":[
+          {
+            "type":"array",
+            "required":true,
+            "message":"Please select files for read2."
+          }
+        ]
+      }
+    },
+    {
+      "tmplType":"file",
+      "label":"FastqScreen Conf File",
+      "model":"fastq_screen_conf",
+      "readOnly":false,
+      "multiple":false,
+      "filterType":"conf",
+      "placeholder":"Select file for fastq screen.",
+      "config":{
+        "initialValue": "oss://pgx-reference-data/fastq_screen_reference/fastq_screen.conf",
+        "rules":[{"required":true,"message":"Please select file for fastq screen."}]
+      }
+    },
+    {
+      "tmplType":"file",
+      "label":"References of Fastq Screen",
+      "model":"screen_ref_dir",
+      "readOnly":false,
+      "filterType":"",
+      "multiple":false,
+      "placeholder":"Select directory for Fastq Screen References.",
+      "config":{
+        "initialValue": "oss://pgx-reference-data/fastq_screen_reference/",
+        "rules":[
+          {
+            "required":true,
+            "message":"Select directory for Fastq Screen References."
+          }
+        ]
+      }
+    },
+    {
+      "tmplType":"file",
+      "label":"Index Directory",
+      "model":"idx",
+      "readOnly":false,
+      "filterType":"",
+      "multiple":false,
+      "placeholder":"Select directory for idx.",
+      "config":{
+        "initialValue": "oss://pgx-reference-data/reference/hisat2/grch38_snp_tran/",
+        "rules":[{"required":true,"message":"Please select directory for idx."}]
+      }
+    },
+    {
+      "tmplType":"file",
+      "label":"GTF File",
+      "model":"gtf",
+      "readOnly":false,
+      "multiple":false,
+      "filterType":"gtf",
+      "placeholder":"Select file for gtf.",
+      "config":{
+         "initialValue": "oss://pgx-reference-data/reference/annotation/Homo_sapiens.GRCh38.93.gtf",
+         "rules":[{"required":true,"message":"Please select file for gtf."}]
+      }
+    },
+    {
+      "tmplType":"input",
+      "type":"string",
+      "label":"Adapter Sequence",
+      "name":"adapter_sequence",
+      "placeholder":"Please enter adapter sequence.",
+      "model":"adapter_sequence",
+      "disabled":false,
+      "min":1,
+      "max":100,
+      "config":{
+        "initialValue":"AGATCGGAAGAGCACACGTCTGAACTCCAGTCA",
+        "rules":[
+          {
+            "type":"string",
+            "required":false,
+            "message":"Please input an adapter sequence."
+          }
+        ]
+      }
+    },
+    {
+      "tmplType":"input",
+      "type":"string",
+      "label":"Adapter Sequence R2",
+      "name":"adapter_sequence_r2",
+      "placeholder":"Please enter adapter sequence.",
+      "model":"adapter_sequence_r2",
+      "disabled":false,
+      "min":1,
+      "max":100,
+      "config":{
+        "initialValue":"AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT",
+        "rules":[
+          {
+            "type":"string",
+            "required":false,
+            "message":"Please input an adapter sequence."
+          }
+        ]
+      }
+    },
+    {
+      "tmplType":"actions",
+      "buttons":[
+        {"type":"cancel","buttonType":"default","buttonLabel":"Previous Step"},
+        {
+          "type":"submit",
+          "buttonType":"primary",
+          "buttonLabel":"Next Step",
+          "validate":true
+        }
+      ]
+    }
+  ]
+}

tasks/ballgown.wdl

+task ballgown {
+    File gene_abundance
+    Array[File] ballgown
+    String sample_id=basename(gene_abundance, ".gene.abundance.txt")
+    String docker
+    String cluster
+    String disk_size
+
+    command <<<
+      mkdir -p /cromwell_root/tmp/${sample_id}
+      cp -r ${sep=" " ballgown} /cromwell_root/tmp/${sample_id}
+      ballgown /cromwell_root/tmp/${sample_id} ${sample_id}.txt
+      sed -i 's/"//g' ${sample_id}.txt
+      sed -i '1s/FPKM./GENE_ID\t/g' ${sample_id}.txt
+    >>>
+    
+    runtime {
+      docker: docker
+      cluster: cluster
+      systemDisk: "cloud_ssd 40"
+      dataDisk: "cloud_ssd " + disk_size + " /cromwell_root/"
+    }
+    
+    output {
+      File mat_expression = "${sample_id}.txt"
+    }
+}

tasks/count.wdl

+task count {
+    File gene_abundance
+    Array[File] ballgown
+    String sample_id=basename(gene_abundance, ".gene.abundance.txt")
+    String docker
+    String cluster
+    String disk_size
+    Int count_length
+
+    command <<<
+      mkdir -p /cromwell_root/tmp/ballgown/${sample_id}
+      cp -r ${sep=" " ballgown} /cromwell_root/tmp/ballgown/${sample_id}
+      count -i /cromwell_root/tmp/ballgown -l ${count_length} -g ${sample_id}_gene_count_matrix.csv -t ${sample_id}_transcript_count_matrix.csv
+      sed -i '1s/gene_id/GENE_ID/g' ${sample_id}_gene_count_matrix.csv
+    >>>
+    
+    runtime {
+      docker: docker
+      cluster: cluster
+      systemDisk: "cloud_ssd 40"
+      dataDisk: "cloud_ssd " + disk_size + " /cromwell_root/"
+    }
+    
+    output {
+      File mat_expression_genecount = "${sample_id}_gene_count_matrix.csv"
+      File mat_expression_transcriptcount = "${sample_id}_transcript_count_matrix.csv"
+    }
+}

tasks/fastp.wdl

+task fastp {
+    File read
+    String sample_id=sub(basename(read1), "\\.(fastq|fq)\\.gz$", "")
+    String adapter_sequence
+    String adapter_sequence_r2
+    String docker
+    String cluster
+    String disk_size
+    String umi_loc	
+    Int trim_front1
+    Int trim_tail1
+    Int max_len1
+    Int trim_front2
+    Int trim_tail2
+    Int max_len2
+    Int disable_adapter_trimming
+    Int length_required
+    Int umi_len
+    Int UMI
+    Int qualified_quality_phred
+    Int length_required1
+    Int disable_quality_filtering
+   
+	command <<<
+        mkdir -p /cromwell_root/tmp/fastp/
+	##1.Disable_quality_filtering
+	if [ "${disable_quality_filtering}" == 0 ]
+        then
+	cp ${read} /cromwell_root/tmp/fastp/{sample_id}.fastq.tmp1.gz
+        else
+	fastp --thread 4 --trim_front1 ${trim_front1} --trim_tail1 ${trim_tail1} --max_len1 ${max_len1} -i ${read} -o /cromwell_root/tmp/fastp/${sample_id}.fastq.tmp1.gz -j ${sample_id}.json -h ${sample_id}.html
+        fi
+
+	##2.UMI
+	if [ "${UMI}" == 0 ]
+        then
+	cp /cromwell_root/tmp/fastp/${sample_id}.fastq.tmp1.gz /cromwell_root/tmp/fastp/${sample_id}.fastq.tmp2.gz
+        else
+	fastp --thread 4 -U --umi_loc=${umi_loc} --umi_len=${umi_len} --trim_front1 ${trim_front1} --trim_tail1 ${trim_tail1} --max_len1 ${max_len1} -i /cromwell_root/tmp/fastp/${sample_id}.fastq.tmp1.gz -o /cromwell_root/tmp/fastp/${sample_id}.fastq.tmp2.gz -j ${sample_id}.json -h ${sample_id}.html
+	fi
+
+	##3.Trim
+        if [ "${disable_adapter_trimming}" == 0 ]
+        then
+	fastp --thread 4 -l ${length_required} -q ${qualified_quality_phred} -u ${length_required1} --adapter_sequence ${adapter_sequence}  --trim_front1 ${trim_front1} --trim_tail1 ${trim_tail1} --max_len1 ${max_len1}  -i /cromwell_root/tmp/fastp/${sample_id}.fastq.tmp2.gz -o ${sample_id}.fastq.gz -j ${sample_id}.json -h ${sample_id}.html
+        else
+	cp /cromwell_root/tmp/fastp/${sample_id}.fastq.tmp2.gz ${sample_id}.fastq.gz
+        fi
+   >>>
+   
+   runtime { 
+		docker: docker
+		cluster: cluster
+		systemDisk: "cloud_ssd 40"
+		dataDisk: "cloud_ssd " + disk_size + " /cromwell_root/"
+   }
+
+   output {
+      File json = "${sample_id}.json"
+      File report = "${sample_id}.html"
+      File Trim = "${sample_id}.fastq.gz"
+   }
+}

tasks/fastqc.wdl

+task fastqc {
+	File read
+	String docker
+	String cluster_config
+	String disk_size
+
+	command <<<
+		set -o pipefail
+		set -e
+		nt=$(nproc)
+		fastqc -t $nt -o ./ ${read}
+	>>>
+
+	runtime {
+		docker:docker
+    	cluster: cluster_config
+    	systemDisk: "cloud_ssd 40"
+    	dataDisk: "cloud_ssd " + disk_size + " /cromwell_root/"
+	}
+	output {
+		File read_html = sub(basename(read), "\\.(fastq|fq)\\.gz$", "_fastqc.html")
+		File read_zip = sub(basename(read), "\\.(fastq|fq)\\.gz$", "_fastqc.zip")
+	}
+}

tasks/fastqscreen.wdl

+task fastq_screen {
+	File read
+	File screen_ref_dir
+	File fastq_screen_conf
+	String readname = basename(read,".fastq.gz")
+	String docker
+	String cluster_config
+	String disk_size
+
+	command <<<
+		set -o pipefail
+		set -e
+		nt=$(nproc)
+		mkdir -p /cromwell_root/tmp
+		cp -r ${screen_ref_dir} /cromwell_root/tmp/
+		#sed -i "s#/cromwell_root/fastq_screen_reference#${screen_ref_dir}#g" ${fastq_screen_conf}
+		fastq_screen --aligner bowtie2 --conf ${fastq_screen_conf} --top 100000 --threads $nt ${read}
+		
+	>>>
+
+	runtime {
+		docker:docker
+    	cluster: cluster_config
+    	systemDisk: "cloud_ssd 40"
+    	dataDisk: "cloud_ssd " + disk_size + " /cromwell_root/"
+	}
+	output {
+		File png = "${readname}_screen.png"
+		File txt = "${readname}_screen.txt"
+		File html = "${readname}_screen.html"
+	}
+}

tasks/hisat2.wdl

+task hisat2 {
+   File idx
+   File Trim
+   String idx_prefix
+   String sample_id=basename(Trim, ".fastq.gz")
+   String docker
+   String cluster
+   String disk_size
+   String pen_intronlen
+   Int pen_cansplice
+   Int pen_noncansplice
+   Int min_intronlen
+   Int max_intronlen
+   Int maxins
+   Int minins
+   
+   command <<<
+      nt=$(nproc)
+      hisat2 -t -p $nt -x ${idx}/${idx_prefix} --pen-cansplice ${pen_cansplice} --pen-noncansplice ${pen_noncansplice} --pen-intronlen ${pen_intronlen} --min-intronlen ${min_intronlen} --max-intronlen ${max_intronlen} --maxins ${maxins} --minins ${minins} --un-conc-gz ${sample_id}_un.fq.gz -1 ${Trim}  -S ${sample_id}.sam 
+   >>>
+   
+   runtime { 
+		docker: docker 
+		cluster: cluster
+		systemDisk: "cloud_ssd 40"
+		dataDisk: "cloud_ssd " + disk_size + " /cromwell_root/"
+   }
+
+   output {
+      File sam = "${sample_id}.sam"
+      File unmapreads = "${sample_id}_un.fq.gz"
+   }
+}

tasks/multiqc.wdl

+task multiqc {
+
+	Array[File] read1_zip
+	Array[File] read2_zip
+
+	Array[File] txt1
+	Array[File] txt2
+
+	Array[File] bamqc_zip
+	Array[File] rnaseq_zip
+
+	String docker
+	String cluster_config
+	String disk_size
+
+	command <<<
+		set -o pipefail
+		set -e
+		mkdir -p /cromwell_root/tmp/fastqc
+		mkdir -p /cromwell_root/tmp/fastqscreen
+		mkdir -p /cromwell_root/tmp/bamqc
+		mkdir -p /cromwell_root/tmp/rnaseq
+
+		cp ${sep=" " read1_zip} ${sep=" " read2_zip} /cromwell_root/tmp/fastqc
+		cp ${sep=" " txt1} ${sep=" " txt2} /cromwell_root/tmp/fastqscreen
+		for i in ${sep=" " bamqc_zip}
+		do
+		  tar -zxvf $i -C /cromwell_root/tmp/bamqc
+		done
+		
+		for i in ${sep=" " rnaseq_zip}
+		do
+		  tar -zxvf $i -C /cromwell_root/tmp/rnaseq
+		done
+		
+
+		multiqc /cromwell_root/tmp/
+		cat multiqc_data/multiqc_fastq_screen.txt > multiqc_fastq_screen.txt
+		cat multiqc_data/multiqc_fastqc.txt > multiqc_fastqc.txt
+		cat multiqc_data/multiqc_general_stats.txt > multiqc_general_stats.txt
+		cat multiqc_data/multiqc_qualimap_bamqc_genome_results.txt > multiqc_qualimap_bamqc_genome_results.txt
+
+	
+	>>>
+
+	runtime {
+		docker:docker
+		cluster:cluster_config
+		systemDisk:"cloud_ssd 40"
+		dataDisk:"cloud_ssd " + disk_size + " /cromwell_root/"
+	}
+
+	output {
+		File multiqc_html = "multiqc_report.html"
+		Array[File] multiqc_txt = glob("multiqc_data/*")
+		File multiqc_fastq_screen = "multiqc_fastq_screen.txt"
+		File multiqc_fastqc = "multiqc_fastqc.txt"
+		File multiqc_general_stats = "multiqc_general_stats.txt"
+		File bamqc_genome_results = "multiqc_qualimap_bamqc_genome_results.txt"
+	}
+}

tasks/qualimapBAMqc.wdl

+task qualimapBAMqc {
+	File bam
+	String bamname = basename(bam,".bam")
+	String docker
+	String cluster_config
+	String disk_size
+
+	command <<<
+		set -o pipefail
+		set -e
+		nt=$(nproc)
+		/opt/qualimap/qualimap bamqc -bam ${bam} -outformat PDF:HTML -nt $nt -outdir ${bamname} --java-mem-size=32G 
+		tar -zcvf ${bamname}_bamqc_qualimap.tar.gz ${bamname}
+		
+	>>>
+
+	runtime {
+		docker:docker
+		cluster:cluster_config
+		systemDisk:"cloud_ssd 40"
+		dataDisk:"cloud_ssd " + disk_size + " /cromwell_root/"
+	}
+
+	output {
+		File bamqc_gz = "${bamname}_bamqc_qualimap.tar.gz"
+		
+	}
+}

tasks/qualimapRNAseq.wdl

+task qualimapRNAseq {
+	File bam
+	File gtf
+	String bamname = basename(bam,".bam")
+	String docker
+	String cluster_config
+	String disk_size
+
+	command <<<
+		set -o pipefail
+		set -e
+		nt=$(nproc)
+		/opt/qualimap/qualimap rnaseq -bam ${bam} -outformat HTML -outdir ${bamname} -gtf ${gtf} -pe --java-mem-size=10G
+		tar -zcvf ${bamname}_rnaseq_qualimap.tar.gz ${bamname}
+		
+	>>>
+
+	runtime {
+		docker:docker
+		cluster:cluster_config
+		systemDisk:"cloud_ssd 40"
+		dataDisk:"cloud_ssd " + disk_size + " /cromwell_root/"
+	}
+
+	output {
+		File rnaseq_gz = "${bamname}_rnaseq_qualimap.tar.gz"
+		
+	}
+}

tasks/samtools.wdl

+task samtools {
+    File sam
+    String sample_id=basename(sam, ".sam")
+    String bam = sample_id + ".bam"
+    String sorted_bam = sample_id + ".sorted.bam"
+    String percent_bam = sample_id + ".percent.bam"
+    String sorted_bam_index = sample_id + ".sorted.bam.bai"
+    String ins_size = sample_id + ".ins_size"
+    String docker
+    String cluster
+    String disk_size
+    Int insert_size
+
+    command <<<
+       set -o pipefail
+       set -e
+       /opt/conda/bin/samtools view -bS ${sam} > ${bam}
+       /opt/conda/bin/samtools sort -m 1000000000 ${bam} -o ${sorted_bam}
+       /opt/conda/bin/samtools index ${sorted_bam}
+       /opt/conda/bin/samtools view -bs 42.1 ${sorted_bam} > ${percent_bam}
+       /opt/conda/bin/samtools stats -i ${insert_size} ${sorted_bam} |grep ^IS|cut -f 2- > ${sample_id}.ins_size
+    >>>
+
+    runtime {
+       docker: docker
+       cluster: cluster
+       systemDisk: "cloud_ssd 40"
+       dataDisk: "cloud_ssd " + disk_size + " /cromwell_root/"
+    }
+
+    output {
+      File out_bam = sorted_bam
+      File out_percent = percent_bam
+      File out_bam_index = sorted_bam_index
+      File out_ins_size = ins_size
+    }
+
+}
+

tasks/stringtie.wdl

+task stringtie {
+    File bam
+    File gtf
+    String docker
+    String sample_id=basename(bam, ".sorted.bam")
+    String cluster
+    String disk_size
+    Int minimum_length_allowed_for_the_predicted_transcripts
+    Int Junctions_no_spliced_reads
+    Float minimum_isoform_abundance
+    Float maximum_fraction_of_muliplelocationmapped_reads
+
+    command <<<
+	nt=$(nproc)
+	mkdir ballgown
+	/opt/conda/bin/stringtie -e -B -p $nt -f ${minimum_isoform_abundance} -m ${minimum_length_allowed_for_the_predicted_transcripts} -a ${Junctions_no_spliced_reads} -M ${maximum_fraction_of_muliplelocationmapped_reads} -G ${gtf} -o ballgown/${sample_id}/${sample_id}.gtf -C ${sample_id}.cov.ref.gtf -A ${sample_id}.gene.abundance.txt ${bam}
+	
+    >>>
+    
+    runtime {
+      docker: docker
+      cluster: cluster
+      systemDisk: "cloud_ssd 40"
+      dataDisk: "cloud_ssd " + disk_size + " /cromwell_root/"
+    }
+    
+    output {
+      File covered_transcripts = "${sample_id}.cov.ref.gtf"
+      File gene_abundance = "${sample_id}.gene.abundance.txt"
+      Array[File] ballgown = ["ballgown/${sample_id}/${sample_id}.gtf", "ballgown/${sample_id}/e2t.ctab", "ballgown/${sample_id}/e_data.ctab", "ballgown/${sample_id}/i2t.ctab", "ballgown/${sample_id}/i_data.ctab", "ballgown/${sample_id}/t_data.ctab"]
+    }
+}

workflow.wdl

+import "./tasks/fastp.wdl" as fastp
+import "./tasks/hisat2.wdl" as hisat2
+import "./tasks/samtools.wdl" as samtools
+import "./tasks/stringtie.wdl" as stringtie
+import "./tasks/fastqc.wdl" as fastqc
+import "./tasks/fastqscreen.wdl" as fastqscreen
+import "./tasks/qualimapBAMqc.wdl" as qualimapBAMqc
+import "./tasks/qualimapRNAseq.wdl" as qualimapRNAseq
+import "./tasks/ballgown.wdl" as ballgown
+import "./tasks/count.wdl" as count
+
+workflow {{ project_name }} {
+	File read
+	File idx
+	File screen_ref_dir
+	File fastq_screen_conf
+	File gtf
+	String fastp_docker
+	String adapter_sequence
+	String fastp_cluster
+	String umi_loc
+	String idx_prefix
+	String pen_intronlen
+	String fastqc_cluster_config
+	String fastqc_docker
+	String fastqscreen_docker
+	String fastqscreen_cluster_config
+	String hisat2_docker
+	String hisat2_cluster
+	String qualimapBAMqc_docker
+	String qualimapBAMqc_cluster_config
+	String qualimapRNAseq_docker
+	String qualimapRNAseq_cluster_config
+	String samtools_docker
+	String samtools_cluster
+	String stringtie_docker
+	String stringtie_cluster
+	String multiqc_cluster_config
+	String multiqc_docker
+	Int multiqc_disk_size
+	Int trim_front1 
+	Int trim_tail1 
+	Int max_len1 
+	Int trim_front2 
+	Int trim_tail2  
+	Int max_len2 
+	Int disable_adapter_trimming
+	Int length_required
+	Int umi_len
+	Int UMI
+	Int qualified_quality_phred
+	Int length_required1
+	Int disable_quality_filtering
+	Int pen_cansplice
+	Int pen_noncansplice
+	Int min_intronlen
+	Int max_intronlen
+	Int maxins
+	Int minins
+	Int fastqc_disk_size
+	Int fastqscreen_disk_size
+	Int qualimapBAMqc_disk_size
+	Int qualimapRNAseq_disk_size
+	Int insert_size
+	Int minimum_length_allowed_for_the_predicted_transcripts
+	Int Junctions_no_spliced_reads
+	Int count_length
+	Float minimum_isoform_abundance
+	Float maximum_fraction_of_muliplelocationmapped_reads
+	String ballgown_docker
+	String ballgown_cluster
+	String disk_size
+	String count_docker
+	String count_cluster
+
+	call fastp.fastp as fastp {
+		input: 
+		read = read,
+		docker = fastp_docker,
+		cluster = fastp_cluster,
+		disk_size = disk_size,
+		adapter_sequence = adapter_sequence,
+		adapter_sequence_r2 = adapter_sequence_r2,
+		umi_loc = umi_loc,
+		trim_front1 = trim_front1,
+		trim_tail1 = trim_tail1, 
+		max_len1  = max_len1,
+		trim_front2  = trim_front2,
+		trim_tail2   = trim_tail2,
+		max_len2  = max_len2,
+		disable_adapter_trimming = disable_adapter_trimming,
+		length_required = length_required,
+		umi_len = umi_len,
+		UMI = UMI,
+		qualified_quality_phred = qualified_quality_phred,
+		length_required1 = length_required1,
+		disable_quality_filtering = disable_quality_filtering
+	}
+
+	call fastqc.fastqc as fastqc {
+		input:
+		read = fastp.Trim,
+		docker = fastqc_docker,
+		cluster_config = fastqc_cluster_config,
+		disk_size = fastqc_disk_size
+	}
+
+	call fastqscreen.fastq_screen as fastqscreen {
+		input:
+		read = fastp.Trim, 
+		screen_ref_dir = screen_ref_dir,
+		fastq_screen_conf = fastq_screen_conf,
+		docker = fastqscreen_docker,
+		cluster_config = fastqscreen_cluster_config,
+		disk_size = fastqscreen_disk_size
+	}
+
+	call hisat2.hisat2 as hisat2 {
+		input: 
+		idx = idx, 
+		idx_prefix = idx_prefix, 
+		Trim = fastp.Trim,
+		docker = hisat2_docker,
+		cluster = hisat2_cluster,
+		disk_size = disk_size,
+		pen_intronlen = pen_intronlen,
+		pen_cansplice = pen_cansplice,
+		pen_noncansplice = pen_noncansplice,
+		min_intronlen = min_intronlen,
+		max_intronlen = max_intronlen,
+		maxins = maxins,
+		minins = minins
+	}
+
+	call samtools.samtools as samtools {
+		input: 
+		sam = hisat2.sam,
+		docker = samtools_docker,
+		cluster = samtools_cluster,
+		disk_size = disk_size,
+		insert_size = insert_size
+	}
+			
+	call qualimapBAMqc.qualimapBAMqc as qualimapBAMqc {
+		input:
+		bam = samtools.out_percent,
+		docker = qualimapBAMqc_docker,
+		cluster_config = qualimapBAMqc_cluster_config,
+		disk_size = qualimapBAMqc_disk_size
+	}
+
+	call qualimapRNAseq.qualimapRNAseq as qualimapRNAseq {
+		input:
+		bam = samtools.out_percent,
+		docker = qualimapRNAseq_docker,
+		cluster_config = qualimapRNAseq_cluster_config,
+		disk_size = qualimapRNAseq_disk_size,
+		gtf = gtf
+	}
+
+	call stringtie.stringtie as stringtie {
+		input: 
+		gtf = gtf, 
+		bam = samtools.out_bam,
+		docker = stringtie_docker,
+		cluster = stringtie_cluster,
+		disk_size = disk_size,
+		minimum_length_allowed_for_the_predicted_transcripts = minimum_length_allowed_for_the_predicted_transcripts,
+		Junctions_no_spliced_reads = Junctions_no_spliced_reads,
+		minimum_isoform_abundance = minimum_isoform_abundance,
+		maximum_fraction_of_muliplelocationmapped_reads = maximum_fraction_of_muliplelocationmapped_reads
+	}
+
+	call ballgown.ballgown as ballgown {
+		input: 
+		docker = ballgown_docker,
+		cluster = ballgown_cluster,
+		ballgown = stringtie.ballgown,
+		gene_abundance = stringtie.gene_abundance,
+		disk_size = disk_size
+	} 
+
+	call count.count as count {
+		input: 
+		docker = count_docker,
+		cluster = count_cluster,
+		ballgown = stringtie.ballgown,
+		disk_size = disk_size,
+                gene_abundance = stringtie.gene_abundance,
+		count_length = count_length
+	} 
+}