......

conf/fastq_screen.conf

@@ -0,0 +1,94 @@
+# This is an example configuration file for FastQ Screen
+
+############################
+## Bowtie, Bowtie 2 or BWA #
+############################
+## If the Bowtie, Bowtie 2 or BWA binary is not in your PATH, you can set 
+## this value to tell the program where to find your chosen aligner.  Uncomment 
+## the relevant line below and set the appropriate location.  Please note, 
+## this path should INCLUDE the executable filename.
+
+#BOWTIE	/usr/local/bin/bowtie/bowtie
+#BOWTIE2 /usr/local/bowtie2/bowtie2
+#BWA /usr/local/bwa/bwa
+
+
+
+############################################
+## Bismark (for bisulfite sequencing only) #
+############################################
+## If the Bismark binary is not in your PATH then you can set this value to 
+## tell the program where to find it.  Uncomment the line below and set the 
+## appropriate location. Please note, this path should INCLUDE the executable 
+## filename.
+
+#BISMARK	/usr/local/bin/bismark/bismark
+
+
+
+############
+## Threads #
+############
+## Genome aligners can be made to run across multiple CPU cores to speed up 
+## searches.  Set this value to the number of cores you want for mapping reads.
+
+THREADS		32
+
+
+
+##############
+## DATABASES #
+##############
+## This section enables you to configure multiple genomes databases (aligner index 
+## files) to search against in your screen.  For each genome you need to provide a 
+## database name (which can't contain spaces) and the location of the aligner index 
+## files.
+##
+## The path to the index files SHOULD INCLUDE THE BASENAME of the index, e.g:
+## /data/public/Genomes/Human_Bowtie/GRCh37/Homo_sapiens.GRCh37
+## Thus, the index files (Homo_sapiens.GRCh37.1.bt2, Homo_sapiens.GRCh37.2.bt2, etc.) 
+## are found in a folder named 'GRCh37'.
+##
+## If, for example, the Bowtie, Bowtie2 and BWA indices of a given genome reside in 
+## the SAME FOLDER, a SINLGE path may be provided to ALL the of indices.  The index 
+## used will be the one compatible with the chosen aligner (as specified using the 
+## --aligner flag).  
+##
+## The entries shown below are only suggested examples, you can add as many DATABASE 
+## sections as required, and you can comment out or remove as many of the existing 
+## entries as desired.  We suggest including genomes and sequences that may be sources 
+## of contamination either because they where run on your sequencer previously, or may 
+## have contaminated your sample during the library preparation step.
+##
+## Human - sequences available from
+## ftp://ftp.ensembl.org/pub/current/fasta/homo_sapiens/dna/
+#DATABASE	Human	/data/public/Genomes/Human_Bowtie/GRCh37/Homo_sapiens.GRCh37
+##
+## Mouse - sequence available from
+## ftp://ftp.ensembl.org/pub/current/fasta/mus_musculus/dna/
+#DATABASE	Mouse	/data/public/Genomes/Mouse/NCBIM37/Mus_musculus.NCBIM37
+##
+## Ecoli- sequence available from EMBL accession U00096.2
+#DATABASE	Ecoli	/data/public/Genomes/Ecoli/Ecoli
+##
+## PhiX - sequence available from Refseq accession NC_001422.1
+#DATABASE	PhiX	/data/public/Genomes/PhiX/phi_plus_SNPs
+##
+## Adapters - sequence derived from the FastQC contaminats file found at: www.bioinformatics.babraham.ac.uk/projects/fastqc
+#DATABASE	Adapters	/data/public/Genomes/Contaminants/Contaminants
+##
+## Vector - Sequence taken from the UniVec database
+## http://www.ncbi.nlm.nih.gov/VecScreen/UniVec.html
+#DATABASE	Vectors		/data/public/Genomes/Vectors/Vectors
+
+DATABASE	Human	/cromwell_root/tmp/fastq_screen_reference/genome
+DATABASE	Mouse	/cromwell_root/tmp/fastq_screen_reference/mouse
+DATABASE	ERCC	/cromwell_root/tmp/fastq_screen_reference/ERCC
+DATABASE	EColi	/cromwell_root/tmp/fastq_screen_reference/ecoli
+DATABASE	Adapter	/cromwell_root/tmp/fastq_screen_reference/adapters
+DATABASE	Vector	/cromwell_root/tmp/fastq_screen_reference/vector
+DATABASE	rRNA	/cromwell_root/tmp/fastq_screen_reference/rRNARef
+DATABASE	Virus	/cromwell_root/tmp/fastq_screen_reference/viral
+DATABASE	Yeast	/cromwell_root/tmp/fastq_screen_reference/GCF_000146045.2_R64_genomic_modify
+DATABASE	Mitoch	/cromwell_root/tmp/fastq_screen_reference/Human_mitoch
+DATABASE	Phix	/cromwell_root/tmp/fastq_screen_reference/phix

defaults

@@ -0,0 +1,61 @@
+{   
+    "fastp_docker": "registry.cn-shanghai.aliyuncs.com/pgx-docker-registry/fastp:0.19.6",
+    "fastp_cluster": "OnDemand bcs.b2.3xlarge img-ubuntu-vpc",
+    "trim_front1": "0",
+    "trim_tail1": "0",
+    "max_len1": "0",
+    "trim_front2": "0",
+    "trim_tail2": "0",
+    "max_len2": "0",
+    "adapter_sequence": "AGATCGGAAGAGCACACGTCTGAACTCCAGTCA",
+    "adapter_sequence_r2": "AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT",
+    "disable_adapter_trimming": "0",
+    "length_required": "50",
+    "length_required1": "20",
+    "UMI": "0",
+    "umi_len": "0",
+    "umi_loc": "umi_loc",
+    "qualified_quality_phred": "20",
+    "disable_quality_filtering": "1",
+    "hisat2_docker": "registry.cn-shanghai.aliyuncs.com/pgx-docker-registry/hisat2:v2.1.0-2",
+    "hisat2_cluster": "OnDemand bcs.a2.3xlarge img-ubuntu-vpc",
+    "idx_prefix": "genome_snp_tran",
+    "idx": "oss://pgx-reference-data/reference/hisat2/grch38_snp_tran/",
+    "fasta": "GRCh38.d1.vd1.fa",
+    "pen_cansplice":"0",
+    "pen_noncansplice":"3",
+    "pen_intronlen":"G,-8,1",
+    "min_intronlen":"30",
+    "max_intronlen":"500000",
+    "maxins":"500",
+    "minins":"0",
+    "samtools_docker": "registry.cn-shanghai.aliyuncs.com/pgx-docker-registry/samtools:v1.3.1",
+    "samtools_cluster": "OnDemand bcs.a2.large img-ubuntu-vpc",
+    "insert_size":"8000",
+    "gtf": "oss://pgx-reference-data/reference/annotation/Homo_sapiens.GRCh38.93.gtf",
+    "stringtie_docker": "registry.cn-shanghai.aliyuncs.com/pgx-docker-registry/stringtie:v1.3.4",
+    "stringtie_cluster": "OnDemand bcs.a2.large img-ubuntu-vpc",
+    "minimum_length_allowed_for_the_predicted_transcripts":"200",
+    "minimum_isoform_abundance":"0.01",
+    "Junctions_no_spliced_reads":"10",
+    "maximum_fraction_of_muliplelocationmapped_reads":"0.95",
+    "fastqc_cluster_config": "OnDemand bcs.b2.3xlarge img-ubuntu-vpc",
+    "fastqc_docker": "registry.cn-shanghai.aliyuncs.com/pgx-docker-registry/fastqc:v0.11.5",
+    "fastqc_disk_size": "150",
+    "qualimapBAMqc_docker": "registry.cn-shanghai.aliyuncs.com/pgx-docker-registry/qualimap:2.0.0",
+    "qualimapBAMqc_cluster_config": "OnDemand bcs.a2.7xlarge img-ubuntu-vpc",
+    "qualimapBAMqc_disk_size": "500",
+    "qualimapRNAseq_docker": "registry.cn-shanghai.aliyuncs.com/pgx-docker-registry/qualimap:2.0.0",
+    "qualimapRNAseq_cluster_config": "OnDemand bcs.a2.7xlarge img-ubuntu-vpc",
+    "qualimapRNAseq_disk_size": "500",
+    "fastqscreen_docker": "registry.cn-shanghai.aliyuncs.com/pgx-docker-registry/fastqscreen:0.12.0",
+    "fastqscreen_cluster_config": "OnDemand bcs.b2.3xlarge img-ubuntu-vpc",
+    "screen_ref_dir": "oss://pgx-reference-data/fastq_screen_reference/",
+    "fastq_screen_conf": "oss://pgx-reference-data/fastq_screen_reference/fastq_screen.conf",
+    "fastqscreen_disk_size": "200",
+    "multiqc_cluster_config": "OnDemand bcs.b2.3xlarge img-ubuntu-vpc",
+    "multiqc_docker": "registry-vpc.cn-shanghai.aliyuncs.com/pgx-docker-registry/multiqc:v1.8",
+    "multiqc_disk_size": "100",
+    "ballgown_docker": "registry.cn-shanghai.aliyuncs.com/pgx-docker-registry/pgx-ballgown:0.0.1",
+    "ballgown_cluster": "OnDemand bcs.a2.large img-ubuntu-vpc"
+    }

inputs

@@ -0,0 +1,65 @@
+{
+	"{{ project_name }}.read1": "{{ read1 }}",
+	"{{ project_name }}.read2": "{{ read2 }}",
+	"{{ project_name }}.sample_id": "{{ sample_id }}",
+	"{{ project_name }}.fastp_docker": "{{ fastp_docker }}",
+	"{{ project_name }}.fastp_cluster": "{{ fastp_cluster }}",
+	"{{ project_name }}.trim_front1": "{{ trim_front1 }}",
+	"{{ project_name }}.trim_tail1": "{{ trim_tail1 }}",
+	"{{ project_name }}.max_len1": "{{ max_len1 }}",
+	"{{ project_name }}.trim_front2": "{{ trim_front2 }}",
+	"{{ project_name }}.trim_tail2": "{{ trim_tail2 }}",
+	"{{ project_name }}.max_len2": "{{ max_len2 }}",
+	"{{ project_name }}.adapter_sequence": "{{ adapter_sequence }}",
+	"{{ project_name }}.adapter_sequence_r2": "{{ adapter_sequence_r2 }}",
+	"{{ project_name }}.disable_adapter_trimming": "{{ disable_adapter_trimming }}",
+	"{{ project_name }}.length_required1": "{{ length_required1 }}",
+	"{{ project_name }}.UMI": "{{ UMI }}",
+	"{{ project_name }}.umi_loc": "{{ umi_loc }}",
+	"{{ project_name }}.umi_len": "{{ umi_len }}",
+	"{{ project_name }}.length_required": "{{ length_required }}",
+	"{{ project_name }}.qualified_quality_phred": "{{ qualified_quality_phred }}",
+	"{{ project_name }}.disable_quality_filtering": "{{ disable_quality_filtering }}",
+	"{{ project_name }}.hisat2_docker": "{{ hisat2_docker }}",
+	"{{ project_name }}.hisat2_cluster": "{{ hisat2_cluster }}",
+	"{{ project_name }}.idx_prefix": "{{ idx_prefix }}",
+	"{{ project_name }}.idx": "{{ idx }}",
+	"{{ project_name }}.fasta": "{{ fasta }}",
+	"{{ project_name }}.pen_cansplice": "{{ pen_cansplice }}",
+	"{{ project_name }}.pen_noncansplice": "{{ pen_noncansplice }}",
+	"{{ project_name }}.pen_intronlen": "{{ pen_intronlen }}",
+	"{{ project_name }}.min_intronlen": "{{ min_intronlen }}",
+	"{{ project_name }}.max_intronlen": "{{ max_intronlen }}",
+	"{{ project_name }}.maxins": "{{ maxins }}",
+	"{{ project_name }}.minins": "{{ minins }}",
+	"{{ project_name }}.samtools_docker": "{{ samtools_docker }}",
+	"{{ project_name }}.samtools_cluster": "{{ samtools_cluster }}",
+	"{{ project_name }}.insert_size": "{{ insert_size }}",
+	"{{ project_name }}.gtf": "{{ gtf }}",
+	"{{ project_name }}.stringtie_docker": "{{ stringtie_docker }}",
+	"{{ project_name }}.stringtie_cluster": "{{ stringtie_cluster }}",
+	"{{ project_name }}.minimum_length_allowed_for_the_predicted_transcripts": "{{ minimum_length_allowed_for_the_predicted_transcripts }}",
+	"{{ project_name }}.minimum_isoform_abundance": "{{ minimum_isoform_abundance }}",
+	"{{ project_name }}.Junctions_no_spliced_reads": "{{ Junctions_no_spliced_reads }}",
+	"{{ project_name }}.maximum_fraction_of_muliplelocationmapped_reads": "{{ maximum_fraction_of_muliplelocationmapped_reads }}",
+	"{{ project_name }}.fastqc_cluster_config": "{{ fastqc_cluster_config }}",
+	"{{ project_name }}.fastqc_docker": "{{ fastqc_docker }}",
+	"{{ project_name }}.fastqc_disk_size": "{{ fastqc_disk_size }}",
+	"{{ project_name }}.qualimapBAMqc_docker": "{{ qualimapBAMqc_docker }}",
+	"{{ project_name }}.qualimapBAMqc_cluster_config": "{{ qualimapBAMqc_cluster_config }}",
+	"{{ project_name }}.qualimapBAMqc_disk_size": "{{ qualimapBAMqc_disk_size }}",
+	"{{ project_name }}.qualimapRNAseq_docker": "{{ qualimapRNAseq_docker }}",
+	"{{ project_name }}.qualimapRNAseq_cluster_config": "{{ qualimapRNAseq_cluster_config }}",
+	"{{ project_name }}.qualimapRNAseq_disk_size": "{{ qualimapRNAseq_disk_size }}",
+	"{{ project_name }}.fastqscreen_docker": "{{ fastqscreen_docker }}",
+	"{{ project_name }}.fastqscreen_cluster_config": "{{ fastqscreen_cluster_config }}",
+	"{{ project_name }}.screen_ref_dir": "{{ screen_ref_dir }}",
+	"{{ project_name }}.fastq_screen_conf": "{{ fastq_screen_conf }}",
+	"{{ project_name }}.fastqscreen_disk_size": "{{ fastqscreen_disk_size }}",
+	"{{ project_name }}.multiqc_cluster_config": "{{ multiqc_cluster_config }}",
+	"{{ project_name }}.multiqc_docker": "{{ multiqc_docker }}",
+	"{{ project_name }}.multiqc_disk_size": "{{ multiqc_disk_size }}",
+	"{{ project_name }}.ballgown_docker": "{{ ballgown_docker }}",
+	"{{ project_name }}.ballgown_cluster": "{{ ballgown_cluster }}",
+	"{{ project_name }}.disk_size": "{{ disk_size if disk_size != '' else 200}}"
+}

tasks/ballgown.wdl

@@ -0,0 +1,25 @@
+task ballgown {
+    File gene_abundance
+    Array[File] ballgown
+    String sample_id
+    String docker
+    String cluster
+    String disk_size
+
+    command <<<
+      mkdir -p /cromwell_root/tmp/${sample_id}
+      cp -r ${sep=" " ballgown} /cromwell_root/tmp/${sample_id}
+      ballgown /cromwell_root/tmp/${sample_id} ${sample_id}.txt
+    >>>
+    
+    runtime {
+      docker: docker
+      cluster: cluster
+      systemDisk: "cloud_ssd 40"
+      dataDisk: "cloud_ssd " + disk_size + " /cromwell_root/"
+    }
+    
+    output {
+      File mat_expression = "${sample_id}.txt"
+    }
+}

tasks/fastp.wdl

@@ -0,0 +1,68 @@
+task fastp {
+    String sample_id
+    File read1
+    File read2
+    String adapter_sequence
+    String adapter_sequence_r2
+    String docker
+    String cluster
+    String disk_size
+    String umi_loc	
+    Int trim_front1
+    Int trim_tail1
+    Int max_len1
+    Int trim_front2
+    Int trim_tail2
+    Int max_len2
+    Int disable_adapter_trimming
+    Int length_required
+    Int umi_len
+    Int UMI
+    Int qualified_quality_phred
+    Int length_required1
+    Int disable_quality_filtering
+   
+	command <<<
+        mkdir -p /cromwell_root/tmp/fastp/
+	##1.Disable_quality_filtering
+	if [ "${disable_quality_filtering}" == 0 ]
+        then
+	cp ${read1} /cromwell_root/tmp/fastp/{sample_id}_R1.fastq.tmp1.gz
+	cp ${read2} /cromwell_root/tmp/fastp/{sample_id}_R2.fastq.tmp1.gz
+        else
+	fastp --thread 4 --trim_front1 ${trim_front1} --trim_tail1 ${trim_tail1} --max_len1 ${max_len1} --trim_front2 ${trim_front2} --trim_tail2 ${trim_tail2} --max_len2 ${max_len2} -i ${read1} -I ${read2} -o /cromwell_root/tmp/fastp/${sample_id}_R1.fastq.tmp1.gz -O /cromwell_root/tmp/fastp/${sample_id}_R2.fastq.tmp1.gz -j ${sample_id}.json -h ${sample_id}.html
+        fi
+
+	##2.UMI
+	if [ "${UMI}" == 0 ]
+        then
+	cp /cromwell_root/tmp/fastp/${sample_id}_R1.fastq.tmp1.gz /cromwell_root/tmp/fastp/${sample_id}_R1.fastq.tmp2.gz
+	cp /cromwell_root/tmp/fastp/${sample_id}_R2.fastq.tmp1.gz /cromwell_root/tmp/fastp/${sample_id}_R2.fastq.tmp2.gz
+        else
+	fastp --thread 4 -U --umi_loc=${umi_loc} --umi_len=${umi_len} --trim_front1 ${trim_front1} --trim_tail1 ${trim_tail1} --max_len1 ${max_len1} --trim_front2 ${trim_front2} --trim_tail2 ${trim_tail2} --max_len2 ${max_len2} -i /cromwell_root/tmp/fastp/${sample_id}_R1.fastq.tmp1.gz -I /cromwell_root/tmp/fastp/${sample_id}_R2.fastq.tmp1.gz -o /cromwell_root/tmp/fastp/${sample_id}_R1.fastq.tmp2.gz -O /cromwell_root/tmp/fastp/${sample_id}_R2.fastq.tmp2.gz -j ${sample_id}.json -h ${sample_id}.html
+	fi
+
+	##3.Trim
+        if [ "${disable_adapter_trimming}" == 0 ]
+        then
+	fastp --thread 4 -l ${length_required} -q ${qualified_quality_phred} -u ${length_required1} --adapter_sequence ${adapter_sequence} --adapter_sequence_r2 ${adapter_sequence_r2} --detect_adapter_for_pe --trim_front1 ${trim_front1} --trim_tail1 ${trim_tail1} --max_len1 ${max_len1} --trim_front2 ${trim_front2} --trim_tail2 ${trim_tail2} --max_len2 ${max_len2} -i /cromwell_root/tmp/fastp/${sample_id}_R1.fastq.tmp2.gz -I /cromwell_root/tmp/fastp/${sample_id}_R2.fastq.tmp2.gz -o ${sample_id}_R1.fastq.gz -O ${sample_id}_R2.fastq.gz -j ${sample_id}.json -h ${sample_id}.html
+        else
+	cp /cromwell_root/tmp/fastp/${sample_id}_R1.fastq.tmp2.gz ${sample_id}_R1.fastq.gz
+	cp /cromwell_root/tmp/fastp/${sample_id}_R2.fastq.tmp2.gz ${sample_id}_R2.fastq.gz
+        fi
+   >>>
+   
+   runtime { 
+		docker: docker
+		cluster: cluster
+		systemDisk: "cloud_ssd 40"
+		dataDisk: "cloud_ssd " + disk_size + " /cromwell_root/"
+   }
+
+   output {
+      File json = "${sample_id}.json"
+      File report = "${sample_id}.html"
+      File Trim_R1 = "${sample_id}_R1.fastq.gz"
+      File Trim_R2 = "${sample_id}_R2.fastq.gz"
+   }
+}

tasks/fastqc.wdl

@@ -0,0 +1,28 @@
+task fastqc {
+	File read1
+	File read2
+	String docker
+	String cluster_config
+	String disk_size
+
+	command <<<
+		set -o pipefail
+		set -e
+		nt=$(nproc)
+		fastqc -t $nt -o ./ ${read1}
+		fastqc -t $nt -o ./ ${read2}
+	>>>
+
+	runtime {
+		docker:docker
+    	cluster: cluster_config
+    	systemDisk: "cloud_ssd 40"
+    	dataDisk: "cloud_ssd " + disk_size + " /cromwell_root/"
+	}
+	output {
+		File read1_html = sub(basename(read1), "\\.(fastq|fq)\\.gz$", "_fastqc.html")
+		File read1_zip = sub(basename(read1), "\\.(fastq|fq)\\.gz$", "_fastqc.zip")
+		File read2_html = sub(basename(read2), "\\.(fastq|fq)\\.gz$", "_fastqc.html")
+		File read2_zip = sub(basename(read2), "\\.(fastq|fq)\\.gz$", "_fastqc.zip")
+	}
+}

tasks/fastqscreen.wdl

@@ -0,0 +1,37 @@
+task fastq_screen {
+	File read1
+	File read2
+	File screen_ref_dir
+	File fastq_screen_conf
+	String read1name = basename(read1,".fastq.gz")
+	String read2name = basename(read2,".fastq.gz")
+	String docker
+	String cluster_config
+	String disk_size
+
+	command <<<
+		set -o pipefail
+		set -e
+		nt=$(nproc)
+		mkdir -p /cromwell_root/tmp
+		cp -r ${screen_ref_dir} /cromwell_root/tmp/
+		#sed -i "s#/cromwell_root/fastq_screen_reference#${screen_ref_dir}#g" ${fastq_screen_conf}
+		fastq_screen --aligner bowtie2 --conf ${fastq_screen_conf} --top 100000 --threads $nt ${read1}
+		fastq_screen --aligner bowtie2 --conf ${fastq_screen_conf} --top 100000 --threads $nt ${read2}
+	>>>
+
+	runtime {
+		docker:docker
+    	cluster: cluster_config
+    	systemDisk: "cloud_ssd 40"
+    	dataDisk: "cloud_ssd " + disk_size + " /cromwell_root/"
+	}
+	output {
+		File png1 = "${read1name}_screen.png"
+		File txt1 = "${read1name}_screen.txt"
+		File html1 = "${read1name}_screen.html"
+		File png2 = "${read2name}_screen.png"
+		File txt2 = "${read2name}_screen.txt"
+		File html2 = "${read2name}_screen.html"
+	}
+}

tasks/hisat2.wdl

@@ -0,0 +1,35 @@
+task hisat2 {
+   File idx
+   File Trim_R1
+   File Trim_R2
+   String idx_prefix
+   String sample_id
+   String docker
+   String cluster
+   String disk_size
+   String pen_intronlen
+   Int pen_cansplice
+   Int pen_noncansplice
+   Int min_intronlen
+   Int max_intronlen
+   Int maxins
+   Int minins
+   
+   command <<<
+      nt=$(nproc)
+      hisat2 -t -p $nt -x ${idx}/${idx_prefix} --pen-cansplice ${pen_cansplice} --pen-noncansplice ${pen_noncansplice} --pen-intronlen ${pen_intronlen} --min-intronlen ${min_intronlen} --max-intronlen ${max_intronlen} --maxins ${maxins} --minins ${minins} --un-conc-gz ${sample_id}_un.fq.gz -1 ${Trim_R1} -2 ${Trim_R2} -S ${sample_id}.sam 
+   >>>
+   
+   runtime { 
+		docker: docker 
+		cluster: cluster
+		systemDisk: "cloud_ssd 40"
+		dataDisk: "cloud_ssd " + disk_size + " /cromwell_root/"
+   }
+
+   output {
+      File sam = "${sample_id}.sam"
+      File unmapread_1p = "${sample_id}_un.fq.1.gz"
+      File unmapread_2p = "${sample_id}_un.fq.2.gz"
+   }
+}

tasks/multiqc.wdl

@@ -0,0 +1,61 @@
+task multiqc {
+
+	Array[File] read1_zip
+	Array[File] read2_zip
+
+	Array[File] txt1
+	Array[File] txt2
+
+	Array[File] bamqc_zip
+	Array[File] rnaseq_zip
+
+	String docker
+	String cluster_config
+	String disk_size
+
+	command <<<
+		set -o pipefail
+		set -e
+		mkdir -p /cromwell_root/tmp/fastqc
+		mkdir -p /cromwell_root/tmp/fastqscreen
+		mkdir -p /cromwell_root/tmp/bamqc
+		mkdir -p /cromwell_root/tmp/rnaseq
+
+		cp ${sep=" " read1_zip} ${sep=" " read2_zip} /cromwell_root/tmp/fastqc
+		cp ${sep=" " txt1} ${sep=" " txt2} /cromwell_root/tmp/fastqscreen
+		for i in ${sep=" " bamqc_zip}
+		do
+		  tar -zxvf $i -C /cromwell_root/tmp/bamqc
+		done
+		
+		for i in ${sep=" " rnaseq_zip}
+		do
+		  tar -zxvf $i -C /cromwell_root/tmp/rnaseq
+		done
+		
+
+		multiqc /cromwell_root/tmp/
+		cat multiqc_data/multiqc_fastq_screen.txt > multiqc_fastq_screen.txt
+		cat multiqc_data/multiqc_fastqc.txt > multiqc_fastqc.txt
+		cat multiqc_data/multiqc_general_stats.txt > multiqc_general_stats.txt
+		cat multiqc_data/multiqc_qualimap_bamqc_genome_results.txt > multiqc_qualimap_bamqc_genome_results.txt
+
+	
+	>>>
+
+	runtime {
+		docker:docker
+		cluster:cluster_config
+		systemDisk:"cloud_ssd 40"
+		dataDisk:"cloud_ssd " + disk_size + " /cromwell_root/"
+	}
+
+	output {
+		File multiqc_html = "multiqc_report.html"
+		Array[File] multiqc_txt = glob("multiqc_data/*")
+		File multiqc_fastq_screen = "multiqc_fastq_screen.txt"
+		File multiqc_fastqc = "multiqc_fastqc.txt"
+		File multiqc_general_stats = "multiqc_general_stats.txt"
+		File bamqc_genome_results = "multiqc_qualimap_bamqc_genome_results.txt"
+	}
+}

tasks/qualimapBAMqc.wdl

@@ -0,0 +1,28 @@
+task qualimapBAMqc {
+	File bam
+	String bamname = basename(bam,".bam")
+	String docker
+	String cluster_config
+	String disk_size
+
+	command <<<
+		set -o pipefail
+		set -e
+		nt=$(nproc)
+		/opt/qualimap/qualimap bamqc -bam ${bam} -outformat PDF:HTML -nt $nt -outdir ${bamname}_bamqc --java-mem-size=32G 
+		tar -zcvf ${bamname}_bamqc_qualimap.zip ${bamname}_bamqc
+		
+	>>>
+
+	runtime {
+		docker:docker
+		cluster:cluster_config
+		systemDisk:"cloud_ssd 40"
+		dataDisk:"cloud_ssd " + disk_size + " /cromwell_root/"
+	}
+
+	output {
+		File bamqc_zip = "${bamname}_bamqc_qualimap.zip"
+		
+	}
+}

tasks/qualimapRNAseq.wdl

@@ -0,0 +1,29 @@
+task qualimapRNAseq {
+	File bam
+	File gtf
+	String bamname = basename(bam,".bam")
+	String docker
+	String cluster_config
+	String disk_size
+
+	command <<<
+		set -o pipefail
+		set -e
+		nt=$(nproc)
+		/opt/qualimap/qualimap rnaseq -bam ${bam} -outformat HTML -outdir ${bamname}_RNAseq -gtf ${gtf} -pe --java-mem-size=10G
+		tar -zcvf ${bamname}_RNAseq_qualimap.zip ${bamname}_RNAseq
+		
+	>>>
+
+	runtime {
+		docker:docker
+		cluster:cluster_config
+		systemDisk:"cloud_ssd 40"
+		dataDisk:"cloud_ssd " + disk_size + " /cromwell_root/"
+	}
+
+	output {
+		File rnaseq_zip = "${bamname}_RNAseq_qualimap.zip"
+		
+	}
+}

tasks/samtools.wdl

@@ -0,0 +1,39 @@
+task samtools {
+    File sam
+    String sample_id
+    String bam = sample_id + ".bam"
+    String sorted_bam = sample_id + ".sorted.bam"
+    String percent_bam = sample_id + ".percent.bam"
+    String sorted_bam_index = sample_id + ".sorted.bam.bai"
+    String ins_size = sample_id + ".ins_size"
+    String docker
+    String cluster
+    String disk_size
+    Int insert_size
+
+    command <<<
+       set -o pipefail
+       set -e
+       /opt/conda/bin/samtools view -bS ${sam} > ${bam}
+       /opt/conda/bin/samtools sort -m 1000000000 ${bam} -o ${sorted_bam}
+       /opt/conda/bin/samtools index ${sorted_bam}
+       /opt/conda/bin/samtools view -bs 42.1 ${sorted_bam} > ${percent_bam}
+       /opt/conda/bin/samtools stats -i ${insert_size} ${sorted_bam} |grep ^IS|cut -f 2- > ${sample_id}.ins_size
+    >>>
+
+    runtime {
+       docker: docker
+       cluster: cluster
+       systemDisk: "cloud_ssd 40"
+       dataDisk: "cloud_ssd " + disk_size + " /cromwell_root/"
+    }
+
+    output {
+      File out_bam = sorted_bam
+      File out_percent = percent_bam
+      File out_bam_index = sorted_bam_index
+      File out_ins_size = ins_size
+    }
+
+}
+

tasks/stringtie.wdl

@@ -0,0 +1,33 @@
+task stringtie {
+    File bam
+    File gtf
+    String docker
+    String sample_id
+    String cluster
+    String disk_size
+    Int minimum_length_allowed_for_the_predicted_transcripts
+    Int Junctions_no_spliced_reads
+    Float minimum_isoform_abundance
+    Float maximum_fraction_of_muliplelocationmapped_reads
+
+    command <<<
+	nt=$(nproc)
+	mkdir ballgown
+	/opt/conda/bin/stringtie -e -B -p $nt -f ${minimum_isoform_abundance} -m ${minimum_length_allowed_for_the_predicted_transcripts} -a ${Junctions_no_spliced_reads} -M ${maximum_fraction_of_muliplelocationmapped_reads} -G ${gtf} -o ballgown/${sample_id}/${sample_id}.gtf -C ${sample_id}.cov.ref.gtf -A ${sample_id}.gene.abundance.txt ${bam}
+	
+    >>>
+    
+    runtime {
+      docker: docker
+      cluster: cluster
+      systemDisk: "cloud_ssd 40"
+      dataDisk: "cloud_ssd " + disk_size + " /cromwell_root/"
+    }
+    
+    output {
+      File covered_transcripts = "${sample_id}.cov.ref.gtf"
+      File gene_abundance = "${sample_id}.gene.abundance.txt"
+      Array[File] ballgown = ["ballgown/${sample_id}/${sample_id}.gtf", "ballgown/${sample_id}/e2t.ctab", "ballgown/${sample_id}/e_data.ctab", "ballgown/${sample_id}/i2t.ctab", "ballgown/${sample_id}/i_data.ctab", "ballgown/${sample_id}/t_data.ctab"]
+      File genecount = "{sample_id}_genecount.csv"
+    }
+}

workflow.wdl

@@ -0,0 +1,135 @@
+import "./tasks/fastp.wdl" as fastp
+import "./tasks/hisat2.wdl" as hisat2
+import "./tasks/samtools.wdl" as samtools
+import "./tasks/qualimapRNAseq.wdl" as qualimapRNAseq
+
+workflow {{ project_name }} {
+	File read1
+	File read2
+	File idx
+	File screen_ref_dir
+	File fastq_screen_conf
+	File gtf
+	String sample_id
+	String fastp_docker
+	String adapter_sequence
+	String adapter_sequence_r2
+	String fastp_cluster
+	String umi_loc
+	String idx_prefix
+	String pen_intronlen
+	String fastqc_cluster_config
+	String fastqc_docker
+	String fastqscreen_docker
+	String fastqscreen_cluster_config
+	String hisat2_docker
+	String hisat2_cluster
+	String qualimapBAMqc_docker
+	String qualimapBAMqc_cluster_config
+	String qualimapRNAseq_docker
+	String qualimapRNAseq_cluster_config
+	String samtools_docker
+	String samtools_cluster
+	String stringtie_docker
+	String stringtie_cluster
+	String multiqc_cluster_config
+	String multiqc_docker
+	Int multiqc_disk_size
+	Int trim_front1 
+	Int trim_tail1 
+	Int max_len1 
+	Int trim_front2 
+	Int trim_tail2  
+	Int max_len2 
+	Int disable_adapter_trimming
+	Int length_required
+	Int umi_len
+	Int UMI
+	Int qualified_quality_phred
+	Int length_required1
+	Int disable_quality_filtering
+	Int pen_cansplice
+	Int pen_noncansplice
+	Int min_intronlen
+	Int max_intronlen
+	Int maxins
+	Int minins
+	Int fastqc_disk_size
+	Int fastqscreen_disk_size
+	Int qualimapBAMqc_disk_size
+	Int qualimapRNAseq_disk_size
+	Int insert_size
+	Int minimum_length_allowed_for_the_predicted_transcripts
+	Int Junctions_no_spliced_reads
+	Float minimum_isoform_abundance
+	Float maximum_fraction_of_muliplelocationmapped_reads
+	String ballgown_docker
+	String ballgown_cluster
+	String disk_size
+
+	call fastp.fastp as fastp {
+		input: 
+		sample_id=sample_id, 
+		read1 = read1, 
+		read2 = read2,
+		docker = fastp_docker,
+		cluster = fastp_cluster,
+		disk_size = disk_size,
+		adapter_sequence = adapter_sequence,
+		adapter_sequence_r2 = adapter_sequence_r2,
+		umi_loc = umi_loc,
+		trim_front1 = trim_front1,
+		trim_tail1 = trim_tail1, 
+		max_len1  = max_len1,
+		trim_front2  = trim_front2,
+		trim_tail2   = trim_tail2,
+		max_len2  = max_len2,
+		disable_adapter_trimming = disable_adapter_trimming,
+		length_required = length_required,
+		umi_len = umi_len,
+		UMI = UMI,
+		qualified_quality_phred = qualified_quality_phred,
+		length_required1 = length_required1,
+		disable_quality_filtering = disable_quality_filtering
+		}
+
+	
+	call hisat2.hisat2 as hisat2 {
+		input: 
+		sample_id = sample_id, 
+		idx = idx, 
+		idx_prefix = idx_prefix, 
+		Trim_R1 = fastp.Trim_R1, 
+		Trim_R2 = fastp.Trim_R2,
+		docker = hisat2_docker,
+		cluster = hisat2_cluster,
+		disk_size = disk_size,
+		pen_intronlen = pen_intronlen,
+		pen_cansplice = pen_cansplice,
+		pen_noncansplice = pen_noncansplice,
+		min_intronlen = min_intronlen,
+		max_intronlen = max_intronlen,
+		maxins = maxins,
+		minins = minins
+	}
+
+	call samtools.samtools as samtools {
+		input: 
+		sample_id = sample_id, 
+		sam = hisat2.sam,
+		docker = samtools_docker,
+		cluster = samtools_cluster,
+		disk_size = disk_size,
+		insert_size = insert_size
+	}
+			
+	call qualimapBAMqc.qualimapBAMqc as qualimapBAMqc {
+		input:
+		bam = samtools.out_percent,
+		docker = qualimapBAMqc_docker,
+		cluster_config = qualimapBAMqc_cluster_config,
+		disk_size = qualimapBAMqc_disk_size
+	}
+
+
+}