You can not select more than 25 topics Topics must start with a letter or number, can include dashes ('-') and can be up to 35 characters long.

defaults 3.2KB

5 년 전
5 년 전
5 년 전
5 년 전
5 년 전
5 년 전
5 년 전
5 년 전
5 년 전
12345678910111213141516171819202122232425262728293031323334353637383940414243444546474849505152535455565758596061626364
  1. {
  2. "fastp_docker": "registry.cn-shanghai.aliyuncs.com/pgx-docker-registry/fastp:0.19.6",
  3. "fastp_cluster": "OnDemand bcs.b2.3xlarge img-ubuntu-vpc",
  4. "trim_front1": "0",
  5. "trim_tail1": "0",
  6. "max_len1": "0",
  7. "trim_front2": "0",
  8. "trim_tail2": "0",
  9. "max_len2": "0",
  10. "adapter_sequence": "AGATCGGAAGAGCACACGTCTGAACTCCAGTCA",
  11. "adapter_sequence_r2": "AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT",
  12. "disable_adapter_trimming": "0",
  13. "length_required": "50",
  14. "length_required1": "20",
  15. "UMI": "0",
  16. "umi_len": "0",
  17. "umi_loc": "umi_loc",
  18. "qualified_quality_phred": "20",
  19. "disable_quality_filtering": "1",
  20. "hisat2_docker": "registry.cn-shanghai.aliyuncs.com/pgx-docker-registry/hisat2:v2.1.0-2",
  21. "hisat2_cluster": "OnDemand bcs.a2.3xlarge img-ubuntu-vpc",
  22. "idx_prefix": "genome_snp_tran",
  23. "idx": "oss://pgx-reference-data/reference/hisat2/grch38_snp_tran/",
  24. "fasta": "GRCh38.d1.vd1.fa",
  25. "pen_cansplice":"0",
  26. "pen_noncansplice":"3",
  27. "pen_intronlen":"G,-8,1",
  28. "min_intronlen":"30",
  29. "max_intronlen":"500000",
  30. "maxins":"500",
  31. "minins":"0",
  32. "samtools_docker": "registry.cn-shanghai.aliyuncs.com/pgx-docker-registry/samtools:v1.3.1",
  33. "samtools_cluster": "OnDemand bcs.a2.large img-ubuntu-vpc",
  34. "insert_size":"8000",
  35. "gtf": "oss://pgx-reference-data/reference/annotation/Homo_sapiens.GRCh38.93.gtf",
  36. "stringtie_docker": "registry.cn-shanghai.aliyuncs.com/pgx-docker-registry/stringtie:v1.3.4",
  37. "stringtie_cluster": "OnDemand bcs.a2.large img-ubuntu-vpc",
  38. "minimum_length_allowed_for_the_predicted_transcripts":"200",
  39. "minimum_isoform_abundance":"0.01",
  40. "Junctions_no_spliced_reads":"10",
  41. "maximum_fraction_of_muliplelocationmapped_reads":"0.95",
  42. "fastqc_cluster_config": "OnDemand bcs.b2.3xlarge img-ubuntu-vpc",
  43. "fastqc_docker": "registry.cn-shanghai.aliyuncs.com/pgx-docker-registry/fastqc:0.11.8",
  44. "fastqc_disk_size": "150",
  45. "qualimapBAMqc_docker": "registry.cn-shanghai.aliyuncs.com/pgx-docker-registry/qualimap:2.0.0",
  46. "qualimapBAMqc_cluster_config": "OnDemand bcs.a2.7xlarge img-ubuntu-vpc",
  47. "qualimapBAMqc_disk_size": "500",
  48. "qualimapRNAseq_docker": "registry.cn-shanghai.aliyuncs.com/pgx-docker-registry/qualimap:2.0.0",
  49. "qualimapRNAseq_cluster_config": "OnDemand bcs.a2.7xlarge img-ubuntu-vpc",
  50. "qualimapRNAseq_disk_size": "500",
  51. "fastqscreen_docker": "registry.cn-shanghai.aliyuncs.com/pgx-docker-registry/fastqscreen:0.12.0",
  52. "fastqscreen_cluster_config": "OnDemand bcs.b2.3xlarge img-ubuntu-vpc",
  53. "screen_ref_dir": "oss://pgx-reference-data/fastq_screen_reference/",
  54. "fastq_screen_conf": "oss://pgx-reference-data/fastq_screen_reference/fastq_screen.conf",
  55. "fastqscreen_disk_size": "200",
  56. "multiqc_cluster_config": "OnDemand bcs.b2.3xlarge img-ubuntu-vpc",
  57. "multiqc_docker": "registry-vpc.cn-shanghai.aliyuncs.com/pgx-docker-registry/multiqc:v1.8",
  58. "multiqc_disk_size": "100",
  59. "ballgown_docker": "registry.cn-shanghai.aliyuncs.com/pgx-docker-registry/pgx-ballgown:0.0.1",
  60. "ballgown_cluster": "OnDemand bcs.a2.large img-ubuntu-vpc",
  61. "count_docker": "registry.cn-shanghai.aliyuncs.com/pgx-docker-registry/count:v1.0",
  62. "count_cluster": "OnDemand bcs.a2.large img-ubuntu-vpc",
  63. "count_length": "150"
  64. }