From fastq to lncRNA profile.
You can not select more than 25 topics Topics must start with a letter or number, can include dashes ('-') and can be up to 35 characters long.

defaults 1.6KB

4 년 전
4 년 전
1234567891011121314151617181920212223242526272829303132333435363738394041
  1. {
  2. "adapter_sequence": "AGATCGGAAGAGCACACGTCTGAACTCCAGTCA",
  3. "adapter_sequence_r2": "AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT",
  4. "fastp_docker": "registry.cn-shanghai.aliyuncs.com/pgx-docker-registry/fastp:0.19.6",
  5. "fastp_cluster": "OnDemand bcs.b2.3xlarge img-ubuntu-vpc",
  6. "umi_loc": "umi_loc",
  7. "trim_front1": "0",
  8. "trim_tail1": "0",
  9. "max_len1": "0",
  10. "trim_front2": "0",
  11. "trim_tail2": "0",
  12. "max_len2": "0",
  13. "disable_adapter_trimming": "0",
  14. "length_required": "50",
  15. "umi_len": "0",
  16. "UMI": "0",
  17. "qualified_quality_phred": "20",
  18. "length_required1": "20",
  19. "disable_quality_filtering": "1",
  20. "idx": "oss://pgx-reference-data/reference/hisat2/grch38_snp_tran/",
  21. "idx_prefix": "genome_snp_tran",
  22. "pen_intronlen":"G,-8,1",
  23. "hisat2_docker": "registry.cn-shanghai.aliyuncs.com/pgx-docker-registry/hisat2:v2.1.0-2",
  24. "hisat2_cluster": "OnDemand bcs.a2.3xlarge img-ubuntu-vpc",
  25. "pen_cansplice":"0",
  26. "pen_noncansplice":"3",
  27. "min_intronlen":"30",
  28. "max_intronlen":"500000",
  29. "maxins":"500",
  30. "minins":"0",
  31. "samtools_docker": "registry.cn-shanghai.aliyuncs.com/pgx-docker-registry/samtools:v1.3.1",
  32. "samtools_cluster": "OnDemand bcs.a2.large img-ubuntu-vpc",
  33. "insert_size":"8000",
  34. "lnc_gtf_file": "oss://pgx-reference-data/reference/subread/lncRNAKB_hg38_v7.gtf",
  35. "subread_docker": "registry.cn-shanghai.aliyuncs.com/pgx-docker-registry/subread:v1.6.4",
  36. "subread_cluster": "OnDemand bcs.a2.large img-ubuntu-vpc",
  37. "cpu_num": "4",
  38. "strand_information": "0",
  39. "gtf_dir": "oss://pgx-reference-data/reference/subread/",
  40. "fasta": "GRCh38.d1.vd1.fa"
  41. }